Review




Structured Review

Baines Food Consultancy ank2 ankyrins
Ank2 Ankyrins, supplied by Baines Food Consultancy, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/ank2+ankyrins/pm18439406-160-8-24
Average 90 stars, based on 1 article reviews
ank2 ankyrins - by Bioz Stars, 2026-09
90/100 stars

Images

Related Articles

other:

Article Title: Drosophila ankyrin 2 is required for synaptic stability.
Article Snippet: Spectrin Is Required for The Synaptic Localization of Ank2 Ankyrins are believed to link transmembrane receptors to the underlying spectrin/actin cytoskeletal mesh (Bennett and Baines, 2001).



Similar Products

91
StressMarq antibodies mouse igg anti ank2 antibody stressmarq ab 11232606 anti ank3 antibody santa cruz biotechnology sc 12719
a Domain structures of short and long <t>Ank2</t> protein variants (220 and 440 kDa, respectively). Note that exon 4 deletion (red star) affects both short and long variants. MBD membrane-binding domain, SBD spectrin-binding domain; linker, a linker for the MBD and SBD domains; giant exon, a domain uniquely present in the long Ank2 variant; DD death domain, CT C-terminal region. b Immunoblot analysis of WT and Ank2-cKO cortical and hippocampal lysates (P21). ( n = 4 mice [WT, cKO], one sample t -test). c Hyperactivity of Ank2-cKO mice (P19–21) in the open-field test (100 lux), as shown by distance moved. The reduced time spent in the center region suggests anxiety-like behavior. ( n = 25 [WT; males and females mixed here and in all other behavioral experiments], 19 [cKO], Mann-Whitney test [total distance moved, center time], two-way repeated-measures/RM-ANOVA with Sidak’s test [distance moved]). d Anxiolytic-like behavior in Ank2-cKO mice (P19–21) in the light-dark test (600 lux), as shown by light-chamber time/entry. ( n = 20 [WT], 17 [cKO], Student’s t -test). e Anxiolytic-like behavior in Ank2-cKO mice (P24–25) in the elevated plus-maze test, as shown by open-arm time/entry. ( n = 18 [WT], 10 [cKO], Student’s t -test). f Normal social interaction and impaired social novelty recognition in Ank2-cKO mice (P19–20) in the three-chamber test, as shown by sniffing time. S1/S2, novel/familiar stranger; O, object. ( n = 18 [WT], 14 [cKO], Mann–Whitney test [WT-S1/O, WT-S1/S2, and cKO-S1/O], Student’s t-test [cKO-S1/S2]). g Abnormally increased social interaction in Ank2-cKO mice (P23–25) in a direct social-interaction test. ( n = 9 [WT], 7 [cKO], Student’s t -test). h Decreased self-grooming and digging, without a change in jumping, in Ank2-cKO mice (P25–27). Note that hyperactivity is observed here, similar to the open-field hyperactivity. ( n = 24 [WT], 17 [cKO], Mann-Whitney test [digging/self-grooming]). Source data for uncropped immunoblot images are provided as a Source Data file. The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/- SEM. P values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.
Antibodies Mouse Igg Anti Ank2 Antibody Stressmarq Ab 11232606 Anti Ank3 Antibody Santa Cruz Biotechnology Sc 12719, supplied by StressMarq, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Anti-Ankyrin+B+Antibody/pmc10272139-468-9-14
Average 91 stars, based on 1 article reviews
antibodies mouse igg anti ank2 antibody stressmarq ab 11232606 anti ank3 antibody santa cruz biotechnology sc 12719 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

ank2  (Bioss)
90
Bioss ank2
A. Primary cultured neurons from P1 pups were infected with CamKII AAV-GFP at DIV 3 (to visualize cell morphology and to identify excitatory neurons) and fixed at DIV 21. The cells were immunostained for Kcc2 and components of the spectrin/ankyrin subnetwork; Sptan1, Sptbn1, <t>Ank2,</t> Itpr1. Colocalization was measured using line scans (white lines), and represent the normalised fluorescent intensity of single pixels (approximately 1 μm) on dendrites (n=3).
Ank2, supplied by Bioss, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Ankyrin+B+Polyclonal+Antibody/bio_rxiv__2020__04__30__071076-188-18-21
Average 90 stars, based on 1 article reviews
ank2 - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology ank2
Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , <t>ANK2</t> , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Ank2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Ankyrin+B+Antibody/pmc12316014-65-18-19
Average 93 stars, based on 1 article reviews
ank2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
OriGene ggttcctgagtcgtatcgcgta
Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , <t>ANK2</t> , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Ggttcctgagtcgtatcgcgta, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Ankyrin+brain+(ANK2)+Human+qPCR+Primer+Pair/pm40359940-212-110-111
Average 93 stars, based on 1 article reviews
ggttcctgagtcgtatcgcgta - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology mouse anti ank2
Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , <t>ANK2</t> , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Mouse Anti Ank2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Ankyrin+B+Antibody/bio_rxiv__2025__04__01__646704-181-11-13
Average 93 stars, based on 1 article reviews
mouse anti ank2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

91
StressMarq samples ethics oversight mouse anti ank2
Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , <t>ANK2</t> , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Samples Ethics Oversight Mouse Anti Ank2, supplied by StressMarq, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Ankyrin+B+Antibody/pmc10272139__41467_2023_39203_MOESM11_ESM-30-74-79
Average 91 stars, based on 1 article reviews
samples ethics oversight mouse anti ank2 - by Bioz Stars, 2026-09
91/100 stars
  Buy from Supplier

93
Santa Cruz Biotechnology primary antibodies to ank2
Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , <t>ANK2</t> , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Primary Antibodies To Ank2, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/Ankyrin+B+Antibody/pm32853419-113-10-15
Average 93 stars, based on 1 article reviews
primary antibodies to ank2 - by Bioz Stars, 2026-09
93/100 stars
  Buy from Supplier

90
Baines Food Consultancy ank2 ankyrins
Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , <t>ANK2</t> , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.
Ank2 Ankyrins, supplied by Baines Food Consultancy, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ank2+ankyrins/ank2+ankyrins/pm18439406-160-8-24
Average 90 stars, based on 1 article reviews
ank2 ankyrins - by Bioz Stars, 2026-09
90/100 stars
  Buy from Supplier

Image Search Results


a Domain structures of short and long Ank2 protein variants (220 and 440 kDa, respectively). Note that exon 4 deletion (red star) affects both short and long variants. MBD membrane-binding domain, SBD spectrin-binding domain; linker, a linker for the MBD and SBD domains; giant exon, a domain uniquely present in the long Ank2 variant; DD death domain, CT C-terminal region. b Immunoblot analysis of WT and Ank2-cKO cortical and hippocampal lysates (P21). ( n = 4 mice [WT, cKO], one sample t -test). c Hyperactivity of Ank2-cKO mice (P19–21) in the open-field test (100 lux), as shown by distance moved. The reduced time spent in the center region suggests anxiety-like behavior. ( n = 25 [WT; males and females mixed here and in all other behavioral experiments], 19 [cKO], Mann-Whitney test [total distance moved, center time], two-way repeated-measures/RM-ANOVA with Sidak’s test [distance moved]). d Anxiolytic-like behavior in Ank2-cKO mice (P19–21) in the light-dark test (600 lux), as shown by light-chamber time/entry. ( n = 20 [WT], 17 [cKO], Student’s t -test). e Anxiolytic-like behavior in Ank2-cKO mice (P24–25) in the elevated plus-maze test, as shown by open-arm time/entry. ( n = 18 [WT], 10 [cKO], Student’s t -test). f Normal social interaction and impaired social novelty recognition in Ank2-cKO mice (P19–20) in the three-chamber test, as shown by sniffing time. S1/S2, novel/familiar stranger; O, object. ( n = 18 [WT], 14 [cKO], Mann–Whitney test [WT-S1/O, WT-S1/S2, and cKO-S1/O], Student’s t-test [cKO-S1/S2]). g Abnormally increased social interaction in Ank2-cKO mice (P23–25) in a direct social-interaction test. ( n = 9 [WT], 7 [cKO], Student’s t -test). h Decreased self-grooming and digging, without a change in jumping, in Ank2-cKO mice (P25–27). Note that hyperactivity is observed here, similar to the open-field hyperactivity. ( n = 24 [WT], 17 [cKO], Mann-Whitney test [digging/self-grooming]). Source data for uncropped immunoblot images are provided as a Source Data file. The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/- SEM. P values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a Domain structures of short and long Ank2 protein variants (220 and 440 kDa, respectively). Note that exon 4 deletion (red star) affects both short and long variants. MBD membrane-binding domain, SBD spectrin-binding domain; linker, a linker for the MBD and SBD domains; giant exon, a domain uniquely present in the long Ank2 variant; DD death domain, CT C-terminal region. b Immunoblot analysis of WT and Ank2-cKO cortical and hippocampal lysates (P21). ( n = 4 mice [WT, cKO], one sample t -test). c Hyperactivity of Ank2-cKO mice (P19–21) in the open-field test (100 lux), as shown by distance moved. The reduced time spent in the center region suggests anxiety-like behavior. ( n = 25 [WT; males and females mixed here and in all other behavioral experiments], 19 [cKO], Mann-Whitney test [total distance moved, center time], two-way repeated-measures/RM-ANOVA with Sidak’s test [distance moved]). d Anxiolytic-like behavior in Ank2-cKO mice (P19–21) in the light-dark test (600 lux), as shown by light-chamber time/entry. ( n = 20 [WT], 17 [cKO], Student’s t -test). e Anxiolytic-like behavior in Ank2-cKO mice (P24–25) in the elevated plus-maze test, as shown by open-arm time/entry. ( n = 18 [WT], 10 [cKO], Student’s t -test). f Normal social interaction and impaired social novelty recognition in Ank2-cKO mice (P19–20) in the three-chamber test, as shown by sniffing time. S1/S2, novel/familiar stranger; O, object. ( n = 18 [WT], 14 [cKO], Mann–Whitney test [WT-S1/O, WT-S1/S2, and cKO-S1/O], Student’s t-test [cKO-S1/S2]). g Abnormally increased social interaction in Ank2-cKO mice (P23–25) in a direct social-interaction test. ( n = 9 [WT], 7 [cKO], Student’s t -test). h Decreased self-grooming and digging, without a change in jumping, in Ank2-cKO mice (P25–27). Note that hyperactivity is observed here, similar to the open-field hyperactivity. ( n = 24 [WT], 17 [cKO], Mann-Whitney test [digging/self-grooming]). Source data for uncropped immunoblot images are provided as a Source Data file. The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/- SEM. P values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Membrane, Binding Assay, Variant Assay, Western Blot, MANN-WHITNEY

a Examples of epileptiform spike discharges in Ank2-cKO mice (P35; parietal right lobe) monitored until death, as shown by electroencephalography (EEG). b Epileptiform discharges in EEG observed in an Ank2-cKO mouse until death. c Juvenile seizure-related death occurring in Ank2-cKO mice during ~P20–50. ( n = 23 [WT], 23 [cKO], Log-rank test). d – h Increased pentylenetetrazole (PTZ)-induced seizures in Ank2-cKO mice (P25–27), as shown by final seizure stage (1–4) reached, latency to stage 2 seizure, animals reached stage 2, and frequency and total duration of stage 2. The stage 2 was mainly compared because of its predominance in the mutant mice. ( n = 17 [WT], 10 [cKO], chi-square test [final seizure stage], Mann-Whitney test [stage 2 latency/duration]). The statistical tests involved two-sided analyses. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a Examples of epileptiform spike discharges in Ank2-cKO mice (P35; parietal right lobe) monitored until death, as shown by electroencephalography (EEG). b Epileptiform discharges in EEG observed in an Ank2-cKO mouse until death. c Juvenile seizure-related death occurring in Ank2-cKO mice during ~P20–50. ( n = 23 [WT], 23 [cKO], Log-rank test). d – h Increased pentylenetetrazole (PTZ)-induced seizures in Ank2-cKO mice (P25–27), as shown by final seizure stage (1–4) reached, latency to stage 2 seizure, animals reached stage 2, and frequency and total duration of stage 2. The stage 2 was mainly compared because of its predominance in the mutant mice. ( n = 17 [WT], 10 [cKO], chi-square test [final seizure stage], Mann-Whitney test [stage 2 latency/duration]). The statistical tests involved two-sided analyses. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Mutagenesis, MANN-WHITNEY

a Examples of neuronal firing in the somatosensory cortex (SSC) in brain slices from Ank2-cKO mice, as measured by multielectrode array (MEA; 64 electrodes in 8 × 8 arrays; cutoff for significant firing > 4.5 x standard deviation). b , c Increased mean firing rate and mean burst rate (inter-spike-interval <10 ms) in the Ank2-cKO SSC (P19–22), as measured by MEA. ( n = 9 slices/3 mice [WT], 10, 3 [cKO], Student’s t -test [total], Welch’s test [layer 2/3], Mann–Whitney test [layer 5]). d Unaltered number of spikes in a single burst in the Ank2-cKO SSC (P19–22) measured by MEA. ( n = 9, 3 [WT], 10, 3 [cKO], Student’s t-test [total], Mann–Whitney test [layer 2/3 and 5]). e Unaltered percentage of spikes in bursts in the Ank2-cKO SSC (P19–22) measured by MEA. ( n = 9, 3 [WT], 10, 3 [cKO], Welch’s test [total], Mann-Whitney test [layer 2/3 and 5]). f Diagram showing examples of local field potentials (LFPs) and depicting parameters of LFP (length and amplitude). g – i Increased duration but normal frequency and amplitude of LFPs in layer 2/3 but not layer 5 in the Ank2-cKO SSC (P19–22) measured by MEA. ( n = 9, 3 [WT], 10, 3 [cKO], Student’s t -test [LFP frequency-layer 2/3, amplitude-total and layer 2/3, duration-total and layer 5], Mann–Whitney test [frequency/amplitude-layer 5], Welch’s test [duration-layer 2/3]). The statistical tests involved two-sided analyses. Data are presented as mean values +/- SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a Examples of neuronal firing in the somatosensory cortex (SSC) in brain slices from Ank2-cKO mice, as measured by multielectrode array (MEA; 64 electrodes in 8 × 8 arrays; cutoff for significant firing > 4.5 x standard deviation). b , c Increased mean firing rate and mean burst rate (inter-spike-interval <10 ms) in the Ank2-cKO SSC (P19–22), as measured by MEA. ( n = 9 slices/3 mice [WT], 10, 3 [cKO], Student’s t -test [total], Welch’s test [layer 2/3], Mann–Whitney test [layer 5]). d Unaltered number of spikes in a single burst in the Ank2-cKO SSC (P19–22) measured by MEA. ( n = 9, 3 [WT], 10, 3 [cKO], Student’s t-test [total], Mann–Whitney test [layer 2/3 and 5]). e Unaltered percentage of spikes in bursts in the Ank2-cKO SSC (P19–22) measured by MEA. ( n = 9, 3 [WT], 10, 3 [cKO], Welch’s test [total], Mann-Whitney test [layer 2/3 and 5]). f Diagram showing examples of local field potentials (LFPs) and depicting parameters of LFP (length and amplitude). g – i Increased duration but normal frequency and amplitude of LFPs in layer 2/3 but not layer 5 in the Ank2-cKO SSC (P19–22) measured by MEA. ( n = 9, 3 [WT], 10, 3 [cKO], Student’s t -test [LFP frequency-layer 2/3, amplitude-total and layer 2/3, duration-total and layer 5], Mann–Whitney test [frequency/amplitude-layer 5], Welch’s test [duration-layer 2/3]). The statistical tests involved two-sided analyses. Data are presented as mean values +/- SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Standard Deviation, MANN-WHITNEY

a Normal resting membrane potential in Ank2-cKO SSC layer 2/3 pyramidal neurons (P19–22). ( n = 12 neurons/8 mice [WT], 22,8 [cKO], Mann–Whitney test). b , c Increased input resistance in Ank2-cKO SSC layer 2/3 neurons (P19–22). ( n = 10, 3 [WT], 12, 3 [cKO], two-way RM-ANOVA with Sidak’s test and Student’s t -test). d Increased current-firing curve slope in Ank2-cKO SSC layer 2/3 neurons (P19–22). ( n = 7, 3 [WT], 9, 3 [cKO], two-way RM-ANOVA with Sidak’s test). e Diagram explaining mAHP. f Decreased mAHP amplitude in Ank2-cKO SSC layer 2/3 neurons (P19–22). ( n = 16, 5 [WT], 21, 5 [cKO], Welch’s test). g Diagram explaining AP threshold and AP shape-related parameters. h – l Normal AP threshold and AP shape-related parameters in Ank2-cKO SSC layer 2/3 neurons (P19–22), as indicated by AP-threshold voltage and the height, width, and time-dependent voltage changes (dV/dt; maximal/depolarizing and minimal/repolarizing) of APs. ( n = 13, 9 [WT], 18, 11 [cKO], Student’s t -test [AP threshold and Max dV/dt and min dV/dt], Mann-Whitney test [FWHM and amplitude]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a Normal resting membrane potential in Ank2-cKO SSC layer 2/3 pyramidal neurons (P19–22). ( n = 12 neurons/8 mice [WT], 22,8 [cKO], Mann–Whitney test). b , c Increased input resistance in Ank2-cKO SSC layer 2/3 neurons (P19–22). ( n = 10, 3 [WT], 12, 3 [cKO], two-way RM-ANOVA with Sidak’s test and Student’s t -test). d Increased current-firing curve slope in Ank2-cKO SSC layer 2/3 neurons (P19–22). ( n = 7, 3 [WT], 9, 3 [cKO], two-way RM-ANOVA with Sidak’s test). e Diagram explaining mAHP. f Decreased mAHP amplitude in Ank2-cKO SSC layer 2/3 neurons (P19–22). ( n = 16, 5 [WT], 21, 5 [cKO], Welch’s test). g Diagram explaining AP threshold and AP shape-related parameters. h – l Normal AP threshold and AP shape-related parameters in Ank2-cKO SSC layer 2/3 neurons (P19–22), as indicated by AP-threshold voltage and the height, width, and time-dependent voltage changes (dV/dt; maximal/depolarizing and minimal/repolarizing) of APs. ( n = 13, 9 [WT], 18, 11 [cKO], Student’s t -test [AP threshold and Max dV/dt and min dV/dt], Mann-Whitney test [FWHM and amplitude]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Membrane, MANN-WHITNEY

a Diagram depicting procedures of PTM (posttranslational modification) analyses for samples from WT and Ank2-cKO cortex and hippocampus; (P19–22) ( n = 3 groups from 9 mice [3 mice/group] [WT, cKO]). b , c DAVID gene ontology (GO) analyses of biological functions for the proteins with up- and downregulated PTM levels (PTM proteins). d – f Volcano plots highlighting the PTM proteins with significant fold changes (>1.5) and p -values (<0.05, Welch’s t-test) and the presence of potassium channels in the down-PTM proteins (fold change > 1.5 and p < 0.05 [Welch’s t -test]). g Diagram depicting procedures of proteomic analysis of total (whole-lysate) proteins in Ank2-cKO mice (cortex + hippocampus; P19–22). h , i Volcano plots showing the differentially expressed proteins (DEPs) derived from the analysis of total (whole-lysate) proteins in Ank2-cKO mice (cortex and hippocampus; P19–22) with significant fold changes (>1.5) and p -values (<0.05) and the presence of Kv7.2 and Kv7.3 in the downregulated total DEPs ( p < 0.05 [Welch’s t -test] but not fold change > 1.5). ( n = 3 mice [WT, cKO]). j Decreased total and crude synaptosomal levels of Kv7.2 and Kv7.3 in Ank2-cKO brains (cortex + hippocampus; P19–23). Note that the levels of Kv2.1, Kv3.1, and Kv1.2 (unrelated control) were not changed. ( n = 4 mice [WT, cKO] except for Kv7.3 in total lysates ( n = 5 mice [WT, cKO]), one sample t -test). k Decreased surface levels of Kv7.2 and Kv7.3 in cultured cortical neurons (DIV 17). ( n = 15 dishes [5 + 5 + 5] from 3 biologically independent experiments [Kv7.2] and 14 dishes [5 + 5 + 4] from 3 biologically independent experiments [Kv7.3], one sample t-test). Source data for uncropped immunoblot images are provided as a Source Data file. The statistical tests involved two-sided analyses. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a Diagram depicting procedures of PTM (posttranslational modification) analyses for samples from WT and Ank2-cKO cortex and hippocampus; (P19–22) ( n = 3 groups from 9 mice [3 mice/group] [WT, cKO]). b , c DAVID gene ontology (GO) analyses of biological functions for the proteins with up- and downregulated PTM levels (PTM proteins). d – f Volcano plots highlighting the PTM proteins with significant fold changes (>1.5) and p -values (<0.05, Welch’s t-test) and the presence of potassium channels in the down-PTM proteins (fold change > 1.5 and p < 0.05 [Welch’s t -test]). g Diagram depicting procedures of proteomic analysis of total (whole-lysate) proteins in Ank2-cKO mice (cortex + hippocampus; P19–22). h , i Volcano plots showing the differentially expressed proteins (DEPs) derived from the analysis of total (whole-lysate) proteins in Ank2-cKO mice (cortex and hippocampus; P19–22) with significant fold changes (>1.5) and p -values (<0.05) and the presence of Kv7.2 and Kv7.3 in the downregulated total DEPs ( p < 0.05 [Welch’s t -test] but not fold change > 1.5). ( n = 3 mice [WT, cKO]). j Decreased total and crude synaptosomal levels of Kv7.2 and Kv7.3 in Ank2-cKO brains (cortex + hippocampus; P19–23). Note that the levels of Kv2.1, Kv3.1, and Kv1.2 (unrelated control) were not changed. ( n = 4 mice [WT, cKO] except for Kv7.3 in total lysates ( n = 5 mice [WT, cKO]), one sample t -test). k Decreased surface levels of Kv7.2 and Kv7.3 in cultured cortical neurons (DIV 17). ( n = 15 dishes [5 + 5 + 5] from 3 biologically independent experiments [Kv7.2] and 14 dishes [5 + 5 + 4] from 3 biologically independent experiments [Kv7.3], one sample t-test). Source data for uncropped immunoblot images are provided as a Source Data file. The statistical tests involved two-sided analyses. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Modification, Derivative Assay, Control, Cell Culture, Western Blot

a – c Increased AIS area (marked by Ank3; arrows) in cultured hippocampal Ank2 fl/fl neurons infected with AAV-Cre (DIV 4 ~ 10–14 ~ 28), and decreased mean intensities of Kv7.3 and Ank3 in the AIS area; these changes together yield normal total intensities of Kv7.3 and Ank3. Note that the width of Ank3 was not changed. ( n = 36 neurons from three independent experiments [WT], 36 [cKO], Welch’s test [Ank3 mean intensity], Mann–Whitney test [Ank3 area/total intensity; Kv7.3 mean/total intensity in AIS]). Scale bar, 10 µm. d – g Increased AIS length and area (marked by Ank3) in the Ank2-cKO somatosensory cortex (P19–23), as determined by three-dimensional imaging and quantification of expanded brain tissues. ( n = 60 neurons from 4 mice [WT], 60, 4 [cKO], Student’s t-test [Ank3 length], Welch’s t -test [Ank3 area]). Scale bar, 4 µm. h – j The Kv7.2/3 antagonist, XE991, increases the slope of the current-spike curve in WT, but not Ank2-cKO, SSC layer 2/3 pyramidal neurons (P19–23). ( n = 7 neurons from 3 mice [WT], 14,4 [WT + XE991], 9,3 [cKO], 13,5 [cKO+XE991], two-way RM-ANOVA with Sidak’s test [i] and with Tukey’s test [j]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a – c Increased AIS area (marked by Ank3; arrows) in cultured hippocampal Ank2 fl/fl neurons infected with AAV-Cre (DIV 4 ~ 10–14 ~ 28), and decreased mean intensities of Kv7.3 and Ank3 in the AIS area; these changes together yield normal total intensities of Kv7.3 and Ank3. Note that the width of Ank3 was not changed. ( n = 36 neurons from three independent experiments [WT], 36 [cKO], Welch’s test [Ank3 mean intensity], Mann–Whitney test [Ank3 area/total intensity; Kv7.3 mean/total intensity in AIS]). Scale bar, 10 µm. d – g Increased AIS length and area (marked by Ank3) in the Ank2-cKO somatosensory cortex (P19–23), as determined by three-dimensional imaging and quantification of expanded brain tissues. ( n = 60 neurons from 4 mice [WT], 60, 4 [cKO], Student’s t-test [Ank3 length], Welch’s t -test [Ank3 area]). Scale bar, 4 µm. h – j The Kv7.2/3 antagonist, XE991, increases the slope of the current-spike curve in WT, but not Ank2-cKO, SSC layer 2/3 pyramidal neurons (P19–23). ( n = 7 neurons from 3 mice [WT], 14,4 [WT + XE991], 9,3 [cKO], 13,5 [cKO+XE991], two-way RM-ANOVA with Sidak’s test [i] and with Tukey’s test [j]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Cell Culture, Infection, MANN-WHITNEY, Imaging

a , b Retigabine treatment (from P16–17) rescues the increased neuronal excitability and firing in Ank2-cKO SSC layer 2/3 pyramidal neurons (P19–23) without affecting WT neurons, as shown by current-firing curves. ( n = 8 neurons from 4 mice [WT-Veh], 8,4 [WT-RTG], 8,4 [cKO-Veh], 8,4 [cKO-RTG], two-way RM-ANOVA with Tukey’s test [a], two-way RM-ANOVA with Sidak’s test [b]). c and d Retigabine treatment (from P16–17) rescues the decreased mAHP (medium afterhyperpolarization) amplitude in Ank2-cKO SSC layer 2/3 neurons (P19–23) without affecting that of WT neurons. ( n = 8, 4 [WT], 8,4 [WT-RTG], 8,4 [cKO], 8,4 [cKO-RTG], two-way RM-ANOVA with Tukey’s test [c], two-way RM-ANOVA with Sidak’s test [d]). e , f Retigabine treatment (from P16–17) does not affect input resistance in Ank2-cKO or WT SSC layer 2/3 neurons (P19–23). ( n = 7,4 [WT], 7,4 [WT-RTG], 7,4 [cKO], 7,4 [cKO-RTG], two-way RM-ANOVA with Tukey’s test [e], two-way RM ANOVA with Sidak’s test [f]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/- SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a , b Retigabine treatment (from P16–17) rescues the increased neuronal excitability and firing in Ank2-cKO SSC layer 2/3 pyramidal neurons (P19–23) without affecting WT neurons, as shown by current-firing curves. ( n = 8 neurons from 4 mice [WT-Veh], 8,4 [WT-RTG], 8,4 [cKO-Veh], 8,4 [cKO-RTG], two-way RM-ANOVA with Tukey’s test [a], two-way RM-ANOVA with Sidak’s test [b]). c and d Retigabine treatment (from P16–17) rescues the decreased mAHP (medium afterhyperpolarization) amplitude in Ank2-cKO SSC layer 2/3 neurons (P19–23) without affecting that of WT neurons. ( n = 8, 4 [WT], 8,4 [WT-RTG], 8,4 [cKO], 8,4 [cKO-RTG], two-way RM-ANOVA with Tukey’s test [c], two-way RM-ANOVA with Sidak’s test [d]). e , f Retigabine treatment (from P16–17) does not affect input resistance in Ank2-cKO or WT SSC layer 2/3 neurons (P19–23). ( n = 7,4 [WT], 7,4 [WT-RTG], 7,4 [cKO], 7,4 [cKO-RTG], two-way RM-ANOVA with Tukey’s test [e], two-way RM ANOVA with Sidak’s test [f]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/- SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques:

a , b Chronic retigabine treatment (from P16–17) improves juvenile seizure-related death of Ank2-cKO mice without affecting WT mice. ( n = 11 mice [WT-Veh/vehicle], 12 [WT-RTG/retigabine], 16 [cKO-Veh], 10 [cKO-RTG], Log-rank test). c , d Cessation of chronic retigabine treatment at around ~P42 (~26 days after the initiation of retigabine treatment) eliminates the treatment effect of retigabine on juvenile seizure-related death in Ank2-cKO mice. ( n = 14 mice [cKO-Veh], 13 [cKO-RTG], Log-rank test). e – g Chronic retigabine treatment (from P16–17) does not improve hyperactivity or anxiety-like behavior (center time) of Ank2-cKO mice in the open-field test. ( n = 11 mice [WT-Veh], 12 [WT-RTG], 11 [cKO-Veh], 10 [cKO-RTG], two-way ANOVA with Tukey test). h – k Acute retigabine treatment (5 mg/kg) at P21/22 improves hyperactivity but not anxiety-like behavior (center time) of Ank2-cKO mice in the open-field test. Drug treatment groups were divided into two (retigabine/saline first) to minimize cross-treatment effects. ( n = 13 mice [WT-Veh], 15 [WT-RTG], 16 [cKO-Veh], 17 [cKO-RTG], two-way ANOVA with Tukey’s test [distance moved_4min], Sidak’s test [distance moved_total]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet: a , b Chronic retigabine treatment (from P16–17) improves juvenile seizure-related death of Ank2-cKO mice without affecting WT mice. ( n = 11 mice [WT-Veh/vehicle], 12 [WT-RTG/retigabine], 16 [cKO-Veh], 10 [cKO-RTG], Log-rank test). c , d Cessation of chronic retigabine treatment at around ~P42 (~26 days after the initiation of retigabine treatment) eliminates the treatment effect of retigabine on juvenile seizure-related death in Ank2-cKO mice. ( n = 14 mice [cKO-Veh], 13 [cKO-RTG], Log-rank test). e – g Chronic retigabine treatment (from P16–17) does not improve hyperactivity or anxiety-like behavior (center time) of Ank2-cKO mice in the open-field test. ( n = 11 mice [WT-Veh], 12 [WT-RTG], 11 [cKO-Veh], 10 [cKO-RTG], two-way ANOVA with Tukey test). h – k Acute retigabine treatment (5 mg/kg) at P21/22 improves hyperactivity but not anxiety-like behavior (center time) of Ank2-cKO mice in the open-field test. Drug treatment groups were divided into two (retigabine/saline first) to minimize cross-treatment effects. ( n = 13 mice [WT-Veh], 15 [WT-RTG], 16 [cKO-Veh], 17 [cKO-RTG], two-way ANOVA with Tukey’s test [distance moved_4min], Sidak’s test [distance moved_total]). The statistical tests involved two-sided analyses, and adjustments were made for multiple comparisons. Data are presented as mean values +/− SEM. P -values in figure panels: * p < 0.05, ** p < 0.01, *** p < 0.001, ns, not significant.

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Saline

Journal: Nature Communications

Article Title: Kv7/KCNQ potassium channels in cortical hyperexcitability and juvenile seizure-related death in Ank2-mutant mice

doi: 10.1038/s41467-023-39203-z

Figure Lengend Snippet:

Article Snippet: The supernatants were incubated with 1 µg of primary antibodies (mouse IgG, anti-Ank2 antibody, StressMarq, AB_11232606; anti-Ank3 antibody, Santa Cruz Biotechnology, sc-12719) at 4 °C for 2 h under rotator.

Techniques: Virus, Recombinant, Software

A. Primary cultured neurons from P1 pups were infected with CamKII AAV-GFP at DIV 3 (to visualize cell morphology and to identify excitatory neurons) and fixed at DIV 21. The cells were immunostained for Kcc2 and components of the spectrin/ankyrin subnetwork; Sptan1, Sptbn1, Ank2, Itpr1. Colocalization was measured using line scans (white lines), and represent the normalised fluorescent intensity of single pixels (approximately 1 μm) on dendrites (n=3).

Journal: bioRxiv

Article Title: Isolation and characterization of multi-protein complexes enriched in the K-Cl co-transporter 2 from brain plasma membranes

doi: 10.1101/2020.04.30.071076

Figure Lengend Snippet: A. Primary cultured neurons from P1 pups were infected with CamKII AAV-GFP at DIV 3 (to visualize cell morphology and to identify excitatory neurons) and fixed at DIV 21. The cells were immunostained for Kcc2 and components of the spectrin/ankyrin subnetwork; Sptan1, Sptbn1, Ank2, Itpr1. Colocalization was measured using line scans (white lines), and represent the normalised fluorescent intensity of single pixels (approximately 1 μm) on dendrites (n=3).

Article Snippet: The following antibodies were used for immunoprecipitation (IP), immunoblot (IB), or immunocytochemistry (Icc): Ank2 (mouse, Icc, Invitrogen 33-3700), Ank2 (rabbit, IB, Bioss BS-6967R-TR), Cntn1 (rabbit, IB), Abcam Ab66265), Itpr1 (rabbit, IB/Icc, Alomone Acc-019), Kcc2 (mouse, IP/Icc, Neuromab 75-013), Kcc2 (rabbit, IB/Icc, Millipore 07-432), Scn2a (mouse, Neuromab 75-024), Scn2a (rabbit, IB, Alomone ASC-002), Sptan1 (mouse, Icc, Abcam Ab11755), Sptan1 (rabbit, IB, Cell Signaling 21225), Sptbn1 (rabbit, IB/Icc, Abcam Ab72239), α-Tubulin (mouse, IB, Sigma T9026).

Techniques: Cell Culture, Infection

Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , ANK2 , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.

Journal: Brain

Article Title: Combined genomics and proteomics unveils elusive variants and vast aetiologic heterogeneity in dystonia

doi: 10.1093/brain/awaf059

Figure Lengend Snippet: Linearly growing number of dystonia-associated genes in the WES cohort . ( A ) Recruitment sites in the study with inclusion of normally underrepresented patient groups and the associated overall diagnostic rates achieved by WES. Geographical areas with underserved dystonia populations and new recruitment foci are highlighted in green. ( B ) Cumulative dystonia patient ascertainment for WES over time, with the number of index patients analysed at the time cut-offs of the study in 2019 –2021 –2024 represented by the size of each point; a detailed description of the recruitment process is provided elsewhere. The number of identified disease genes increased with increasing cohort size with no signs of plateauing. The diagnostic yield was relatively stable at ∼19%–22%. Disease genes identified by WES in the entire cohort over a decade are as follows [alphabetical order; 141/205 (68.8%) found in a single family only; for details, see ]: AARS1 , ACTB , ADAR , ADCY5 , AFG3L2 , ALS2 , ANK2 , ANO3 , AOPEP , ARHGEF9 , ARSA , ASXL3 , ATL1 , ATM , ATP1A3 , ATP2B2 , ATP5F1A , ATP5F1B , ATP5MC3 , ATP7B , ATP8A2 , AUTS2 , BCL11B , BRAF , BRPF1 , C19orf12 , CACNA1A , CACNA1E , CAMK4 , CAMTA1 , CASK , CD40LG , CHD3 , CHD4 , CHD8 , CNTNAP1 , COQ8A , CP , CSDE1 , CTNNB1 , CUL3 , CUX1 , CWF19L1 , DCAF17 , DDC , DHCR24 , DHDDS , DLG4 , DLL1 , DNAJC6 , DNM1L , DNMT1 , EBF3 , ECHS1 , EEF1A2 , EFTUD2 , EIF2AK2 , EIF4A2 , ERCC4 , ERCC8 , FA2H , FBXO31 , FGF14 , FITM2 , FOXG1 , FOXP2 , FRMD5 , FRYL , FTL , GABBR2 , GABRA1 , GAD1 , GCH1 , GJA1 , GJC2 , GNAL , GNAO1 , GNB1 , GRIA2 , GRIA3 , GRID2 , GRIN1 , GRIN2A , HECW2 , HEXA , HIBCH , IFIH1 , IMPDH2 , INTS11 , IRF2BPL , KCNA2 , KCNB1 , KCNJ10 , KCNMA1 , KCTD17 , KIF1A , KIF5A , KMT2B , LIG4 , LRRK2 , MAG , MATR3 , MECP2 , MECR , MED23 , MICU1 , MMAA , MORC2 , MRE11 , MSL3 , NAA15 , NARS2 , NAV3 , NEFL , NFIX , NGLY1 , NKX2-1 , NPC1 , NR4A2 , NUP54 , OPA1 , PAK1 , PANK2 , PARK7 , PCDH12 , PDE10A , PDHA1 , PINK1 , PLA2G6 , PNKD , PNPLA6 , POGZ , POLG , POLR1A , POLR3A , PPP2R5D , PPT1 , PRKCG , PRKN , PRRT2 , PSEN1 , PTS , PURA , RALA , RARB , RERE , RHOBTB2 , SATB1 , SCN2A , SCO2 , SCP2 , SERAC1 , SETX , SGCE , SHANK3 , SHQ1 , SLC16A2 , SLC19A3 , SLC20A2 , SLC2A1 , SLC6A1 , SLC6A3 , SLC9A6 , SNAP25 , SNX14 , SON , SOX2 , SOX6 , SPAST , SPG11 , SPG7 , SPR , SPTBN1 , SRRM2 , SUCLG1 , SUOX , SYNE1 , TBC1D24 , TBCD , TBX1 , TCF20 , TECPR2 , TFE3 , TH , THAP1 , TMEM240 , TOR1A , TTPA , TUBB4A , UBE3A , UBTF , VLDLR , VPS16 , WAC , WARS2 , WASHC5 , WDR45 , WDR73 , WFS1 , YY1 , ZC4H2 , ZEB2 , ZMYND11 , ZNF142 , ZNF335 . ( C ) Pedigrees for three families (black fill, individual with dystonia; grey fill, individual with neurodevelopmental phenotype without dystonia; index patients indicated with arrows) with ANK2 heterozygous predicted loss-of-function (pLoF) variants, and the positions of the variants mapped to the ANK2 protein sequence; ANK2 pLoF mutations previously reported in autism and other NDDs are shown in the protein schematic for comparison ( bottom ). Patient ANK2-GM-A was identified via GeneMatcher. The dystonia-related ANK2 variants p.Glu346* and p.Thr1269Hisfs*19 were absent from gnomAD v4.1.0; p.Arg1427* was present in a single gnomAD-v.4.1.0 subject, as seen for an increasing number of NDD-causing variants associated with variable expressivity ; p.Arg1427* has also been identified in independent clinically affected individuals (listed as ‘likely pathogenic’ in ClinVar, ID: 3338732). Immunoblotting performed on fibroblasts from one WES-cohort individual (M-WES-S143) and three controls (C1–C3) showed significantly reduced ANK2 expression in the patient, compatible with the described haploinsufficiency mechanism of the disorder. Blots are representative of three biological replicates (see also ); in bar plots for quantification, results are shown as mean ± standard deviation represented by error bars (statistical significance determined by Student’s t -test). +/− = monoallelic variant carrier; +/+ = homozygous reference allele; ANK2 , NM_001148.6. ( D ) Burden testing to demonstrate significant enrichment of heterozygous CHD3 pLoF variants in adult-onset isolated dystonia. Differences in carrier rates of rare (MAF < 0.0005) pLoF variants (defined as nonsense, frameshift and splice-site alterations) between all individuals with late adulthood-onset isolated dystonia in the WES cohort ( n = 303) and controls from gnomAD-v.2.1.1 [non-Finish European (NFE) subset, n = 64 603] were determined according to established methods (Test Rare vAriants with Public Data/TRAPD approach). , A flow chart of the analysis strategy is shown. Quantile-quantile plots for the study of NDD-associated genes ( n = 1615; SysNDD database ) and all CCDS genes ( n = 20 000) highlight a single significant signal for CHD3 ( P < 3.1 × 10 −5 and P < 2.5 × 10 −6 , respectively, indicated with dashed horizontal lines; Fisher’s exact test; genomic inflation factor λ is provided). CCDS = consensus coding sequence; gnomAD = Genome Aggregation Database; MAF = minor allele frequency; NDD = neurodevelopmental disorder; WES = whole-exome sequencing; WGS = whole-genome sequencing.

Article Snippet: Total protein lysates processed by sodium dodecyl sulfate (SDS)-polyacrylamide gel electrophoresis were probed with the following primary antibodies: ANK2 (Santa Cruz, sc-12718, 1:1000), GLS (GeneTex, GTX131263, 1:5000), GAPDH (Sigma, G8795-25UL, 1:20 000) and β-tubulin (abeomics, 11-13002, 1:5000).

Techniques: Diagnostic Assay, Sequencing, Comparison, Western Blot, Expressing, Standard Deviation, Variant Assay, Isolation